'Gorgeous Genome' (and Gorgeous George, part man, part genome pictured as well)
POSTED 21 FEB 2002

  Bombs 'n genes

Genetics moves on

Genetic building blocks

Making medicines match

Proteins first, genes second

 

The Human Genome Project is decoding, letter by letter, the sequence of 3 billion nucleotide bases in the human genome. Just one misplaced letter can cause disease.
Courtesy National Institutes of Health.

 

 

 

 

 

 

 

Diagram of a DNA strand.
Courtesy National Institutes of Health.

  Genomic gibberish?
GGCACGAGGGTAAATATGGCATAAGTTAATAACA
CTTTTCCCCAAAATGGTGCTTTGGATTTGAAAAGG
GTCTGATGGGGAGAAGGAGAACGTATCATCCTAGC
TTCCTCTCTTAATAAACCTAGAAAAACGGGTAGTA
AACTGTGGATAGTCAGGAAAACACCCAGCAAGGGA
CACAGC TGTCAGGAAATGAATCTTCCCCCCAACCC
CCACCATGCAGATGGATAGACAGAATCTTTCCTGA
CTAGTCATTAGGATCAGGGGCCTCTGTTGGATTTGT
GTTTCTTGAAGAATAGCTGGCAGAGTGGTATAAAA
GACACGAATATCTCCTGGTCTATAAGGATACTCTGA
TTTGGGGTTTGCATTTTTCATGGTTTTTATTTCCTGT
TCCCCCTGGAGTTTTCCATTAGTGAGTTTTTG

Hands holding pencil examine DNA code. Exciting, isn't it? This gibberish, a bit of genetic sequence, is nonetheless the biggest story in biology. The near-completion of the human genome -- the elaboration of what our DNA looks like at the molecular level -- was an epic story of scientific competition -- documented in this kind of impenetrable, repetitive string of A, C, G and T.

It may be the book of life, but DNA, the two-stranded molecule that forms the pattern for the structure of almost every organism, reads as a simple and incredibly useful "sequence."

Understanding DNA has been the holy grail of biology for decades, and now, with two announcements in February, 2001, the genome is largely complete -- although dark spots exist where the DNA was uncooperative.

What have we already learned from the genome project?

* It's wanting. Among the 3 billion base pairs, scientists think there are roughly 30,000 genes -- only twice as many as a nematode. But the average gene can make three proteins, not one, as yesterday's conventional wisdom held.

* It's common. At Genebank, you can see that various proteins work in many groups of organisms -- mammals, fish, even bacteria.

A DNA strand, showing adenine (A), thymine (T), Guanine (G) and Cytosine (C), the four bases on the helical molecule. * It's trash. No more than 1.5 percent of the human genome contains DNA that maps for proteins. These so-called "exons" are interspersed with all sorts of non-coding regions.

* It's bacterial. The genome project found 223 genes in humans that match those in bacteria -- but are not found in intermediate organisms like fruit flies. Apparently, these genes jumped from bacteria to humans -- or vice versa -- but the mechanism of movement is not understood. This finding reflects the decoding of full picture of the genetic endowmentn, or genomen, of dozens of simple organisms.

What's what at the genetic vanguard?
With the completion of a rough draft of the human genome, geneticists are thinking about the next steps. Three prominent genetic scientists laid out their vision for the future of genomics in November, 1998, in talks at the New Horizons in Science meeting, hosted by Boston University.

Does nature build proteins like a kid with Legos?

 

 

  back more
       
  The Why Files   There are 1 2 3 4 5 pages in this feature.
Bibliography | Credits | Feedback | Search

Terry Devitt, editor; Pamela Jackson, project assistant; S.V. Medaris, designer/illustrator; David Tenenbaum, feature writer; Amy Toburen, content development executive.

©2002, University of Wisconsin, Board of Regents.