First animal ancestor discovered in deep mud!

The evolutionary jump from prokaryotic to eukaryotic cells has eluded scientists searching for evidence of intermediate single-celled life. Discovery of Lokiarchaeota, the closest known prokaryotic relative of eukaryotes, confirms that eukaryotes evolved from Archaea.
“Prokaryotic,” from the Greek pro- (before) and karyon (a nut or kernel), refers to cells that lack a nucleus for housing genetic material. Archaea are prokaryotes equipped to thrive in the harshest environments, like volcanic hot springs or the ocean deep. Eukaryotes (eu- = “well”), on the other hand, have nuclei and other membrane-bound organelles that support the diversity of complex life, from amoebas and fungi to redwoods, to humans.
Genealogists around the world were jealous-green at yesterday's announcement that a single-celled organism living 2.5 kilometers under the ocean off the coast of Norway represents a long-sought relative of all cells with a nucleus -- the eukaryotes.
This distant relative, formally Lokiarcheota, barely reproduces and scrounges leftovers after the microbes above it have eaten their fill.
Forgive the cliché, but Loki is a game changer. For many years, biologists have tried to trace the first nucleus-bearing cells to the simpler cells that came before -- but with little or no evidence either way, the result was mainly academic discord.
Now we know: Genetics prove that Loki, although not yet sophisticated enough to have a nucleus, had the same ancestor as eukaryotes -- as us.
That's a big deal, as Loki is a member of the ancient microbial domain Archaea. Many have thought that eukaryotes descended from Bacteria -- the other giant domain of nucleus-free microbes.
Ancestral attack
We complimented corresponding author Thijs Ettema, an associate professor of cell and molecular biology at Uppsala University in Sweden, on discovering our ancestor, but he clarified that it's not an ancestor: "This is the cousin of the eukaryotes, from 2 billion years ago, give or take half a billion years."
We remained impressed: Here was an Archaea that, like all Archaea, lacked genes for a nucleus, yet it has genes for complex structures that were until now considered unique to eukaryotes.

Although little is known about how Loki made a living (only its genes are known), this distant ancestor does not live large. "Microbes that live on the ocean floor thrive on anything that might fall down," Ettema told us. "Since Loki was a meter deep in the sediment, all these microbes above it are able get to those nutrients first. It was eating whatever was left."
Living near 0°C, Loki may divide only once in a decade.
Having identified a new organism that we share an ancestor with, Ettema cautions that "We are looking at a modern-day organism that is not identical to our common ancestor." Two billion years ago, "Earth was a completely different world, there would not have been a lot of oxygen in the atmosphere or ocean; it was not an environment that was very friendly to modern organisms."
Genetic ju-jitsu
Lacking any specimens, Ettema's group relied on metagenomics -- the systematic construction and comparison of genes. The process starts with "shotgun sequencing," a quick method for reading one organism's genome from samples that may contain hundreds of microbe species:
DNA is isolated and cut into short strands.
Using high-speed sequencing, the letters in each strand are read (for example, TATTTACGCGATTC TGAGAGTTC) and CTTGACATTATTTACGCGATTC).
Identical sections are digitally overlapped to make longer strands and eventually the full genome. (In the example, the identical bold sequences overlap, showing where the fragments join.)
Organisms are identified through a variable stretch of RNA called 16S, which "is a marker used worldwide to answer the question, ‘Who is there?’" says Ettema. "It's a sort of barcode."
High-intensity sequencing and computing produced a microbe with an ancient relationship to all higher organisms.

Read the genes, read the story
Loki was an Archaea, but it carried many genetic signatures of eukaryotes. "We identified about 100 genes that Loki uniquely shares with eukaryotes, that were considered unique to them," Ettema says.
These genes
form parts of ribosomes, which make proteins;
make actin, a protein that shapes cells through a structure called the cytoskeleton;
form vesicles, containers that transport and store chemicals; and
take up objects -- even organisms -- from the environment. This could have allowed eukaryotes to consume the microbes that became mitochondria -- internal energy machines.
And thus Loki is part of the long lineage of eukaryotes -- people, plants, fungi and the rest -- and all of that descended from Archaea. "We have known very little about the timing of the events surrounding the development of eukaryotes," Ettema says. "Now we know that some amount of cell complexity occurred before the nucleus or the organelles came into play. There was already a toolkit."
– David J. Tenenbaum
Kevin Barrett, project assistant; Terry Devitt, editor; S.V. Medaris, designer/illustrator; David J. Tenenbaum, feature writer
Bibliography
- Complex Archaea that bridge the gap between prokaryotes and eukaryotes, Anja Spang et al, Nature, 6 May 2015. ↩
- The Vital Question: Finding answers about theorigin of life. ↩
- Researchers may have solved origin-of-life conundrum. ↩
- New theory suggests alternate path led to rise of the eukaryotic cell. ↩